Hes right. Its not a computer program or a software, but its extremely similar, remarkably similar. Hauntingly similar. Instead of having 00101010111010 10100101010 0001111010 011010101010 Its AGAGAGCCGCTTCGATCGATCG ATCG DTAGCT ACTCGGT Looks like gobbldy gook, but its essential that those 0s and 1s be in the right order in order for life (or your computer program) to function properly. DNA even has an autocorrect device (except for, unlike mans autocorrect, Gods autocorrect actually FIXES mistakes rather than fixes what isnt broken). The DNA molecule has been made in such a way that it is self correcting. There are special proteins called enzymes that go up and down the DNA molecule looking for errors and making repairs on a minute by minute, second by second basis. We have something called editorial type enzymes. Just as an editor of a newspaper scans the newspaper looking for mistakes and then corrects the grammatical or spelling errors, so DNA has special enzymes that go up and down the DNA strand, repairing the mistakes….in such a way that are unbelievably complex. Pretty cool for something that supposedly came about by blind, undirected processes, wouldnt you think? :P Its also astounding that information could come about by blind, undirected processes when we have never witnessed a code coming about by any cause other than intelligent agents. But don’t let this little factoid stop you from being an atheist. ;)
Posted on: Sat, 19 Oct 2013 21:42:15 +0000
Recently Viewed Topics
© 2015